Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ698224
Length 265 bp
Fasta Format > whsd11n13
tgctggtcgccctggtggcggcaatgntcctggtagcctccgacgcggcg atctcctgcggtcaggtgaactctgccctggcctcctgcgtctcctacnc aaaangnagcggggccagcccgcctggggcctgctgttccgganttagga gattggccggcttagcgnggagcaccgccgacaaacaagcggcatgcagg tgcatcaagagtgctgccggtgggctcaaccccggaaaggctgcaagtat cccctccaagtgcng
Download
page-top