Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ698213
Length 669 bp
Fasta Format > whsd11m22
agggatcggctccgccgccgacgccgagagaggatgagctaccagcaggt ccctccgcaggagtcctacccgccgccagggtattcgccggtgtacccgc cgccggccggcgggcagcagggcccgtactacccgccgcagcagcagcan ccgccgccgcctccggggtaccagggatacttcagccagggccagccaca gcagccaccgccctactactacccgcccccgccgccgcacantggccatc accaccacggccaccaccaccatgaccaccacgccgaggaccaccaccac caccatggtcatcatcaccaccaccaccacaacgacgatgactgctgcct tggcttcctcaaaggatggttggccgctctatgctgctgctgctgtctgg aggagtgctgctgctgtttctggtaatgtgcgtgcttggaanctactcgt gtcttgcatgttcgacattgggcatgccgcagtatccagtgaatcttctg gcttgttattatgtgtagctatatgaacttagtctgttacctgtgtcaaa taaactgtgtttacattgtttgctgaactgcttgggccatggatgaacgg tgttgtgcaaagtgtacatgatccagacttgactgtattttattggttga ttgtggaaacttggtgctg
Download
page-top