Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ702225
Length 704 bp
Fasta Format > whsd8f09
gtaaggagaagactcacatcaacatcgtggtcattggccacgtcgactct ggcaagtcgacgaccactggccacctgatctacaagcttggaggcattga caagcggtgatcgagaggttcgagaaggaagccgctgaaatgaacaagag gtctttcaagtacgcctgggtgcttgacaagctcaaggccgagcgtgaga gaggtatcaccatcgatattgccctctggaagtttgagacaaccaagtac tactgcaccgtcattgatgcccctggtcaccgtgacttcatcaagaacat gatcaccggtacctcccaggctgactgtgctgttctcatcatcgactcca ccactggtggttttgaggctggtatctccaaggatggccagacacgtgag cacgccctccttgctttcactcttggagtgaagcagatgatctgctgctg caacaagatggacgccaccactcccaagtactcgaaggctcgttacgaag aaattgttaaggaggtctcttcgtacctgaagaaggtcggctacaaccct gacaaggttcccttcgtccccatctctgggttcgagggtgacaacatgat tgagaggtccaccaaccttgactggtacaagggcccaaccctgcttgagg cacttgaccagatcaacgagcccaagaggccctcagacaagcccctccgt cttc
Download
page-top