Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ702217
Length 703 bp
Fasta Format > whsd8e24
atcatctcctcacctctcaaccaagccaaggccaagagcccagtgaagca gcggccatggagggcaaggaggaggacgtgcggctgggcgcgaaccgcta ctcggagcaccagcccatcggcacggcggcgcagggcggcggcgcggacg agaaggactacaaggagccgcccccggcccccttcttcgaggccggggag ctcacctcctggtccttctaccgggcggggatcgccgagttcctggccac cttcctcttcctctacatctcggtgctcaccgtgatgggcgtggtgggca acccgtccgggtccaagtgcggcacggtcggcatccagggcatcgcctgg agcttcggcggcatgatcttcgtgctcgtctactgcaccgccggcatctc cggcggccacatcaaccccgcggtcaccttcgggctgttcctggccagga agctgtcgctcaccagggccgtgttctacatcgtgatgcagtgcctgggc gccatatgcggcgccggcgtggtgaaggggttccagaccacgctgtacca gggcaacggcggcggcgccaactccgtcncgcccgggtacaccaangggg acnggctcnncnccnanatcntcnncacnttcntgctgntgtacaccntc ttctccnncaccnannccaannncannnccananactctcanntncccat nct
Download
page-top