Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ702157
Length 506 bp
Fasta Format > whsd8a20
gtgaancancggccatggagggcaaggaggaggacgtgcggctgggcgcg aaccgctactcggagcaccagcccatcggcacggcggcgcagggcggcgg cgcggacganaaggactacaaggagccgcccccggcccccttcttcgagg ccggggagctcacctcctggtccttctaccgggcggggatcgccgagttc ctggccaccttcctcttcctctacatctcggtgctcaccgtgatgggcgt ggtgggcaacccgtccgggtccaagtgcngcacggtcggcatccagggca tcgcctggagcttcggcggcatgatcttcgtgctcgtctactgcaccgcc ggcatctccggcggccacatcaaccccgcggtcaccttcgggctgttcct ggncaggaanctgtcgctcaccagggccgtgttctacatcntgatgcagt gcctgggcgccatatgcngcgccggcgtgntgaangggttccagaccacn ctgtac
Download
page-top