Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ225161
Length 606 bp
Fasta Format > whdl20n16
ttcggcacgagggtttcagttctcctccgcctccggtctcgagagctcgc cagnaatggtcgcccacaggttccaccagtaccaggtggtgggtcgcgcg ctgccggcccccggcgatgagcagcccaagatctaccgcatgaagctctg ggccaccaatgaggtccgcgccaagtccaagttctggtacttcctgagga agctcaagaaggtgaagaaggccaacggccagatgctcgccatcaacgag atctttgagaagaaccccaccacaatcaagaactacggcatctggctgag gtaccagagcaggaccggttaccacaacatgtacaaggagtaccgtgaca cgaccctcaacggcggggtggagcagatgtacacggagatggcgtcgcgg caccgcgtgcgtgccccctgcatccagatcatcaagactgcgacggtgga cttcaagctgtgcaagagggacaacacgaagcagttccacaactcgaaga tcaagttcccgcttggtgtaccaggaaggttcgcccacccacccgcaagc tcaagaccacctacaaggcgacgaggcccaacctctttcatgtgagcggg tcccta
Download
page-top