Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ701981
Length 704 bp
Fasta Format > whsd7f10
cctctccttccttcgagtttgcttcagccatgggtaaggagaagactcac atcaacatcgtggtcattggccacgtcgactctggcaagtcgacgaccac tggccacctgatctacaagcttggaggcattgacaagcgtgtgatcgaga ggttcgagaaggaagccgctgaaatgaacaagaggtctttcaagtacgcc tgggtgcttgacaagctcaaggccgagcgtgagagaggtatcaccatcga tattgccctctggaagtttgagacaaccaagtactactgcaccgtcattg atgcccctggtcaccgtgacttcatcaagaacatgatcaccggtacctcc caggctgactgtgctgttctcatcatcgactccaccactggtggttttga ggctggtatctccaaggatggccagacacgtgagcacgccctccttgctt tcactcttggagtgaagcagatgatctgctgctgcaacaagatggacgcc accactcccaagtactcgaaggctcgttacgaagaaattgttaaggaggt ctcttcgtacctgaagaaggtcggctacaaccctgacaaggttcccttcg tccccatctctgggttcgagggtgacaacatgattgagaggtccaccaac cttgactggtacaagggcccaaccctgcttgaggcacttgaccagatcaa cgag
Download
page-top