Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ701779
Length 610 bp
Fasta Format > whsd6g23
ctcaccatctccagctgagctcaacaccactactactgcaaactcaatag ggatggctcgcggtgcagctactcagctcgtgctggtcgccatggtggcc gctatgctcctcgtagcctgcgatgcggcgatatcctgcggtcaggtgac ctctgccttgagcccctgcatctcctatgcacgcggcaatgtcgccaacc cgcctgcggcctgctgcagcggcgtcaggagtctggccggtgcagcccgg agcaccgccgacaagcaagcagcgtgcaagtgcatcaagagcgctgctgg tgggctcaacgctggcaaggccgccggcatcccttcaaagtgcggcgtca gcgtcccctacgccatcagctcatctgtggactgttctaagattcgttga tcgaccacttcttctcatcatcgctgcatatagctccagcgatctacgct gagtacgattgaggtcatacacatacatatacatatatatgaataagtgc tctcatattatctcactgcgtgacagcgagaggagtacctacgtccggcc agctctgcatggcaggccacactgttgtattgatgtttggttgttccttc aaaaaaanna
Download
page-top