Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ701377
Length 732 bp
Fasta Format > whsd4n19
tgatggtcttcaagggaattgccttcatgccttcccatacttgttgatag gatgggcaatgaaattacacgacttacggcggtcaaggcatttgcggtga ttgcaaattcacctcttcgtattgatctttcatgtgtcttggaccatgtc gtttctgagctcacagctttccttcgaaaggccaacagagcccttaggca ggcaacattgggaaccctaaattctctggttgtcacatatgggagtcaaa ttggctcgtcctcttatgaaacgatattagctgaactttctactctcata agtgacggcgatttgcatatggccgctctagcattggaactgtgttgcac aataatggtcgacagaagatccgttaaaaatgttggtttagctgtgaaac aaaaagttttgcctgaggcccttactttgatcaggagtgctctgttgcaa ggacaagcactgcaggcgctacagaagttttttgctgcactggtccaatc tgcaaatataagctttgaaactttgttgaactcccttatttctactgcta aaccatcacagtcaggcggtctttccaagcaggcactattctctattgca cagtgtgttgctgtgctatgcctagcagctggtgatcagaagtgtgcatc aactattgaaatgcttaaaggcattcttaatgatgacagctctactaatt ctgctaaacaacacatggcctngttatgtttg
Download
page-top