Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ701220
Length 566 bp
Fasta Format > whsd4d03
tcgtgctggtcgccatggtggccgctatgctcctcgtagcctgcgatgcg gcgatatcctgcggtcaggtgacctctgccttgagcccctgcatctccta tgcacgcggcaatgtcgccaacccgcctgcggcctgctgcagcggcgtca ggagtctggccggtgcagcccggagcaccgccgacaagcaagcagcgtgc aagtgcatcaagagcgctgctggtgggctcaacgctggcaaggccgccgg catcccttcaaagtgcggcgtcagcgtcccctacgccatcagctcatctg tggactgttctaagattcgttgatcgaccacttcttctcatcatcgctgc atatagctccagcgatctacgctgagtacnattgaggtcatacacataca tatacatatatatgaataagtgctctcatattatctcactgcgtgacagc gagaggagtacctacgtccggccagctctgcatggcaggccacactgttg tattgatgtttggttgttccttcacccttttgagaggactcatgagtttg ttcttcaaaaaaaaaa
Download
page-top