Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ701184
Length 708 bp
Fasta Format > whsd4b04
aacccccatccgtccgtccgtcccggggagaagaccgccggcggaggaga ggagacgcgggcgaggcaagaggagagtcaaatccccatcttgctccccc ccccgcgccgccgaccccacccgcggcattctctccggcgtccctcctcc ggccagggggaaaagcagcagcaggatggtgctgtgggtcttcgggtatg ggtccctgatctggaaccccggattcgacttcgacgagaagatcctggga ttcatcaagggatacaagcgaacgtttaatcttgcttgcattgaccatag aggcacaccacagcatccggccaggacctgcacccttgaatccgaagatg aagccatatgctggggaattgcttattgtgtcaaaggtggtctagaaaaa gagcgagaagcaatgcagtacttggagagaagagaatgcgagtatgacca gaagatctctgtggatttctacaaggatggaaattctctggaaccagctg tgacggatgtattagttttcgtatccactcctgatccagttggcaacaaa tactatcttggccctgctgctttggaggatatggcaaggcaaattgctac agccagtggccctaatggatataatagggactacctgttctcaatggaga aggcactgtccaatataagccatgaagacgactcgatcattgtgcttgcg gatgangt
Download
page-top