Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ697829
Length 759 bp
Fasta Format > whsd10c09
accgaaatccccaattccccaccaccgacagcgtcggtgagagagatggc gtcggcgacggagatgcagccgctggcaccgtcgggctaccgccgggcgc cggagatgaaggagaaggtggaggcgtcgtcgatcgacctggaggcgggg aacggggagacgctctacccggggatctcgcgcggggagaacgccctccg ctggggcttcatccgcaaggtctacggcatcctctgcgcgcagctggtcc tcaccaccgtcgtctccgccatcaccgtcttctaccccaccctcaacgcc acgctctccaactcgcccgtcctcgcgctcgtgctcgccgtcctcccctt catcctgatgatcccattgtacatctatcagcacagacaccctcacaatc ttgctatcttgggtttgttcactctgtgcttgagcttcagcattggtgtg gcttgtgcaaacactgaaggaactattgtgcttcaagcattggtactgac ctcagctgtggttgtctctctgactgcatacacattctgggccgcaaaga agggcaaggaatttagttaccttggaccgtttctgttttctgctctcacc atcctggtcgtgataagctttacccagatcttcttcccatttggacctgc atcgaatgctgtgatcggtgggtttggagctctagtcttctcaggcttca tcgtctacgacactgagaacttgataaagcgccacacttatgacgagtac atctgggcg
Download
page-top