Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ697819
Length 171 bp
Fasta Format > whsd10b17
tctggtcgtgacccaaaagaagtagcacaaaggccaggtttggagttggc ctaattgcatgtggtggagattgtgtgaaaaaggtcaatgttccanctgc anagttacatcaacggaaagttcaggagaataagaaccctgctgcagaag tcgcaaacgtgcccaaacgta
Download
page-top