Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ697817
Length 662 bp
Fasta Format > whsd10b14
catccgacgctgcacccccagcgccatgggccagtgactctgcaactacg ccgttgtttcagaggaagaagactaatggagatcatggagcatcatcatc gtcgtcgtcgtctcctgctttcatgcagcagcagcaattggcagtacagc aggatagttacatgcagagcagagctgaggctcttcaaaatgtggaatca accatccatgagctgagcaacatttttacccagctggcaaccatggtgtc tcagcagggagagttagcaatcagaatcgatgagaacatggaggagacgg tagccaacgtcgagggagcgcagggccaactcttgaagtacctcaacagc atctcgtcaaacaggtggctgatgatgaagatattcttcgtgctgatggt gttcctcatgatcttcatattcttcgtggcatgatccccaccccttgtaa cgcatgttgtgtgcaagtatattctttaatttttaccgaactacatacac catgtacacaattttcactgggatgatgatgataagcggcaggcagtcta gtagcctccgtggtcatgtaaattgggggaagcatccaggatggatctgt tgttactaccgaccgggcggtagtattatatttttattacagtatgtttt ataaaaaaaaaa
Download
page-top