Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ697806
Length 740 bp
Fasta Format > whsd10a14
aagcagtgaagagtagctagcatccatggcgtgcatcaataccttgcaga gctgctccatgttcaaaggggccaagagtaaggccagaagaggtagagcc agtggcgggacctttgagtgccgggcgtccacgttcatggacgggagcgg gctccggctcgggctcgacgagaaccccgatgccatcatctccggggagt ggcccgagaacttctccctcctcagctacgacgacctccgcgcatacctc cagtcacagcagcagcagcagcaacaacaaccatcccatgccggcgatca gcagcgggggcctctcctgcgtgaggccatgtcgacgcccgtgctgatgg tcacagcggagcaggcgctggtggaggttgaaggccacttccagctcgtg tcaggcctcccggttgtcgacagtgcccgccgatgtgtcggggtcgtcgt caagagcgatcacgtgagggcttcacatgggccaaagacgaagattgcag atgtgatgacatctccagcaatcacgctatcatgcgataaaacagtgacc gatgccgcagctctgatgctcaggaagaagatccacagattaccgatagt aaaccaggacaatcaagtaataggtatagttacccgcgatgacgttcttc ncgcgttggaggccatgctgaagttttanagatgcaggagtccatgcccg gtacttgtggatctgtaaatatgtgtgtccgcggtacttt
Download
page-top