Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ697804
Length 646 bp
Fasta Format > whsd10a11
ggtccacaactacagctaactcggtcgagatggctcgcactgcagctact aagctcgtgctggtcgccctggtggcggcaatgatcctcgcagcctccga cgcggccatcagctgcggccaggtgagctctgccttgaccccctgcgtcg cctatgcgaagggcagcgggaccagcccgtctggggcctgctgcagcggc gtcaggaaattggccggcttagcgcggagcaccgccgacaagcaagctac atgcaggtgcctcaagagtgttgccggagggctcaaccccaacaaggccg caggcattccctccaagtgcggcgtcagcgtcccctacacgatcagcgca tccgtggactgctctaagatccactgatcgatttctggccgccatcatcg ccgattatagttccagcgattgatgctgagtacgttgaggtctcacacac acatatatacatatacatgaataaatgctctgatatgatctccatgtgag agataggagtacgtacatcgagccagctttgcatagctggccactgttgt atctattttgtatcagcgtttgattgttcgttcactccctttgagcagac acgggagtttgttgtactttgtacgatgtacgcttatcatatatgg
Download
page-top