Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ697803
Length 719 bp
Fasta Format > whsd10a10
ctcccgcggcgaaaccctagcgaccggagcgctcggcggcggcagccatg gcggacgacgactataatgaagttgacatggggtacgaggatgagcctcc agaggctgatattgaggaaggggttgaagaagatcctgagaacaacgagg atgcccctgatgacgtggtagggggtgaaggtgaagaaaaggaacaggaa aagactgcccgtccacgcaatacaacaaaatatatgaccaagtatgagcg ggcacgcatccttggcacacgtgctttgcagataagcatgaatgccccag ttatggttgagcttgagggtgaaactgatcctcttgagattgccatgaaa gaactgagagcacgtaagatccccttcacgattaggcgctacttacctga tggaagctacgaggactggggagttgacgagctcattgtggaggactcgt ggaagcgtcaggttggcggggactagagctggtagactgttcgaatggga ggctccgtgctgcaactaaactttgccctagtagctatatgcaatctttg gcactgaactgccgcgacaatgttatgttaccgtaacatgtgtgggctat gtctgcccattgtgttgtgctactactgtaaaccaattgcgtggttgcgt tagtttgcttggaccattgcttgcatgcagctacaagttgcgaatgaata ccctactctaacctccttt
Download
page-top