Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591770
Length 640 bp
Fasta Format > rwhsc9p18
gcggtacaacgtacaataaagtctcggttctcctcaaaggtagtgaaagt aaaaacaaccatagtagtagtacaatagttgccggccatgcagagctagc tcggcgtacgcactcctttctccctcacatggagatcagatcagagcatt tattcatatgtattagagacctcagcatactcagcggtgatggatggcgc tatggacggcagccatggtgggcagtggttgatcagcgaatcttagagca gtcgacgttagcgctgattgcatatgggacgctgacgccgcacttggagg ggatgccggcggccttgccagcgttgagcccaccggcagcgctcttgatg cacttgcacgccgcttgcttgtcagcggtgctccgggctgccccggccag actcctgacaccgctgcagcaggcagcagtcgggttggcgccattgccgc gggcataggagatgcaggggctcaaggcggaggtcacctgaccgcangag atggccgcgtcggtggctacnaggagcatantggccaccatggcgaccan cacnancggaatanctgcaccgcgagccatccctatcnagtttgcantan taatcntgttgaactcanctgganatggtganancctcnt
Download
page-top