Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591517
Length 708 bp
Fasta Format > rwhsc9b24
aaggtttcacaaagtatgagctagcagtatttagacgacagataataggc caaaaatttcgactcagccagaccagatgctacaaactgctctaacgaat aggcagataggttatgtagagcttccttctctaggccttcctggcaatct gggactcagcctccttcttcaccggctcttccttctccgacaagatcagc tcaatgtggcatgggttggacatgtaggggttgatgcgtccatgggcacg gtaggtccggcgccgctgcttctgggcctggttcacttggatgtgtgaaa tgtagagagcatcaacatcaagacctttcacctcagcattgctctcagca ttctttagaagatccagaacgaacttagcagacttggcaggccagcgtcc ctgaccattgggctgacggttcttcacctgggctgtgcgtccaacaccac ggcagtacctccggaaggggatggcttgcttgtgtgccaacacatcctca aggtacctcttggccttgttgagcgacatcttcctcagggcaaacgctgt ttccctagtgttcttgaaatgaacacgcaggtcccggcccatggccttgg cggacttggtgggattggcgggatccgtcgagtacttcaccatggctgcn gcggtgcantanancctcntgccgaattcngnacnangcctcnngccnaa ttcctnca
Download
page-top