Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591449
Length 715 bp
Fasta Format > rwhsc8n24
catttccggctcccagaatagagtaaccatgctgaaagttgaaaaataaa caaaaaaaagaagatcaacaatcttcagctggcatgactccacttcacaa aaggattagcacaccacatctatatgtactagtatcaagtagtattaact aaagacagacgcaatgacacagaaccatccttcaaaatgaggcaacaagt tgagattaacacagatggcaatacgcggcagggtaactcttgtgatctag tgcttcttgttcttcgggatcttcgacaggaccttctcttcaaagatggc ataatacttcttcaattcgatcatggccttctcaccaaaagcatccacct tgtcatcgtacttctcatacagaactggcacagtgtacagcaccacaaag actatatatgacagtgtcaaaaagttgcagtagctcccaagaacagaaag aagccagagccctccaatcacaatgaggaatttcttcagatcacgaccat gaccagtctctctcaaggtaaagaagccccggttgatctcatgccgcagt gatagtgcaatgtttacagtcatgtcctccgggattttcacctcagggat gttcgggggagacttgtggatgaaaatgcagacattggaatagaggaaga gggttgccagggagaggatgaggcagtggcccaccaaggtgagcagatgg tactccatgacctcg
Download
page-top