Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591220
Length 372 bp
Fasta Format > rwhsc8b19
catcccaggtggtttgcagtactcattgcacagatacttaggtctcaaac atattaaatccgcaaaattcgacctaaaagcacataagataagtaatcct tagcataaaagattccacaggagaactggaattgaactgcttagtcgaac aagctgaagcccatgtcatcatcgctctcttccttagcctcctccttttt ctcttctttcttctcttcagcggcagcagcaccaccagcagccggggcag cagcagcagcagctggagcaccacctccaccagatccgacggaaaggatg aggtcatcgacgctcctcttctccaggagcttggcgaagagcgcgggcca gtaggcctcaaccttgattccg
Download
page-top