Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591200
Length 708 bp
Fasta Format > rwhsc8a20
gtatcagtagtattaactaaagacagacgcaatgacacagaaccatcctt caaaatgaggcaacaagttgagattaacacagatggcaatacgcggcagg gtaactcttgtgatctagtgcttcttgttcttcgggatcttcgacaggac cttctcttcaaagatggcataatacttcttcaattcgatcatggccttct caccaaaagcatccaccttgtcatcgtacttctcatacagaactggcaca gtgtacagcaccacaaagactatatatgacagtgtcaaaaagttgcagta gctcccaagaacagaaagaagccagagccctccaatcacaatgaggaatt tcttcagatcacgaccatgaccagtctctctcaaggtaaagaagccccgg ttgatctcatgccgcagtgatagtgcaatgtttacagtcatgtcctccgg gattttcacctcagggatgttcgggggagacttgtggatgaaaatgcaga cattggaatagaggaagagggttgccagggagaggatgaggcagtggccc accaaggtgagcagatggtactccatgacctcgaacagcagccagatggc agtagcgccagcaagcacccctccggagaccttcttgttcctccatagaa caagatcagcaggcttgccgccgccgaggacggcgtggacgggcttctcg cggccgaa
Download
page-top