Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591028
Length 331 bp
Fasta Format > rwhsc7g05
agatagtgatattacatgataaaacaacaaaaataaaagaaatatatcaa gccacaagatagcatcaatcaagaaaaatgcgcgggaggaagaaatttag ccaagaaacaccgatgactgaaactagtagtggaattcatttgccttctt gaaaaccccagcttgggcagaagcagcaccatcagaggtcacggccacga cgatacagtccttcacctgctgggtggtaaatgggaacttcttgttcaca atggagttgaggtatgcagctgccccctcacgtatcagggcgccaatacc atcagttctagtgtttgagagtgcatcatgc
Download
page-top