Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ590995
Length 720 bp
Fasta Format > rwhsc7e13
acagagcagctcaaagttcacacacatgaccaccaaacgttacaactcat gtattcccatgtaaacaaggaaaaactgacagaatatcacaggctgggcc cggctagttcgtcagttccatgatagcactgactatgtcaccgtcagcag atttgagcgccttcacagccttgggcctaggcacaccggcctgggtcatc accagttcaatgtccttaggctcaactccagtctcatcacaatcctcgtc atcctcctgaacagctgtagaagcctcagggtttgagatgacgctgctaa gatcaggcgctttgaattgctcggcagcctgggactgcagctgtgagctc agatcctcaatcttagcctcaccgaaaatgacataggtgtcagaggcagg gctcttgaatacatctggcttggagatgacaaacaggatattcttgctct tcttgacagttacacggctcacgccagtgatagtcttcatgccaagcttc agcatggccttcctgctcttcttctcactcctactctgcttagatcttcc acttgcatcaactccctcaacatcatcatctttgtcatcctcgtcatcat catcctcatcttcctcatcatcatcatcctcaactacgggctcgtctccc tgcgcagcgagcttctgctcttccagaacggcgcggagcagctccgcctg cgtcgcggtctcggccgtca
Download
page-top