Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ589573
Length 194 bp
Fasta Format > rwhsc20p03
ganggcgggcttgacctcggcatacttgcgggtcttgagaccgcagtcgg ggttcacccacaagatgttggtgtcnagcaccgcnagcatcttgttgaca cggtcggngatctcctccttggacgggatcctgggggagtggatgtntta cactcccgggccaatgccggcgccntacaccannccctcncgga
Download
page-top