Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ589333
Length 652 bp
Fasta Format > rwhsc20b24
gatagcgtacatcgtacaagtacaacaaactcccgtgtctgctcaaaggg agtgaacgaacaatcaaacgctgatacaaaatagatacaacagtggccag ctatgcaaagctggctcgatgtacgtactcctatctctcacatggagatc atatcagagcatttattcatgtatatgtatatatgtgtgtgtgagacctc aacgtactcagcatcaatcgctggaactataatcggcgatgatggcggcc agaaatcgatcagtggatcttagagcagtccacggatgcgctgatcgtgt aggggacgctgacgccgcacttggagggaatgcctgcggccttgttgggg ttgagccctccggcaacactcttgaggcacctgcatgtagcttgcttgtc ggcggtgctccgcgctaagccggccaatttcctgacgccgctgcagcagg ccccagacgggctggtcccgctgcccttcgcataggcgacgcagggggtc aaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgag gatcattgccgccaccagggcgaccagcacgagtttagtagctgcagtgc gagccatctcgaccgagttanctgtagttgtggaccttgtggtggtgggc ta
Download
page-top