Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ589309
Length 724 bp
Fasta Format > rwhsc20a12
catttccggctccgatagagtaaccatgctgaaagttgaaaaataaacaa aaaaaagaagatcaacaatcttcagctggcatgactccacttcacaaaag gattagcacaccacatctatatgtactagtatcaagtagtattaactaaa gacagacgcaatgacacagaaccatccttcaaaatgaggcaacaagttga gattaacacagatggcaatacgcggcagggtaactcttgtgatctagtgc ttcttgttcttcgggatcttcgacaggaccttctcttcaaagatggcata atacttcttcaattcgatcatggccttctcaccaaaagcatccaccttgt catcgtacttctcatacagaactggcacagtgtacagcaccacaaagact atatatgacagtgtcaaaaagttgcagtagctcccaagaacagaaagaag ccagagccctccaatcacaatgaggaatttcttcagataacgaccatgac cagtctctctcaaggtaaagaagccccggttgatctcatgccgcagtgat agtgcaatgtttacagtcatgtcctccgggattttcacctcagggatgtt cgggggagacttgtggatgaaaatgcagacattggaatagaggaagaggg ttgccagggagaggatgaggcagtggcccaccaaggtgagcagatggtac tccatgacctcgaacagcagccag
Download
page-top