Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ589074
Length 610 bp
Fasta Format > rwhsc1c16
gtacgtacaactcagacttagatgatgaacaattcgccactcagtttaca atacacaccgacaaccgcctcaaaaaccaccaaatcaaagggatgagcac atggcgccgcgccgcgccgagaaacaaactagcctaaccaacaggtggat acagagacccagattattcaaagtaaacacggctatggtggcgacatcct ccttgcaattaaaatgggggagctgctatacggcttactgcgccttggcg agctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcggg cttgacctcggcatacttgcgggtcttgagaccgcagtcggggttcaccc acaggatgttggtgtcgagcaccgcgagcatcttgttgacacggtcggcg atctcctccttggacgggatcctgggggagtggatgtcgtacacgcccgg gccaatgccggcgccgtacaccacgccctcgcggaanacgganagaagct tctcgtcggaccgcgagttctcnatggtgatcacatcngcgtccatgttg atgatggactggatgatgtcnttgaanttgnantancacatgtggntgtg gatctnnntg
Download
page-top