Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ589041
Length 512 bp
Fasta Format > rwhsc1a18
gtggtggcttagggatccagacttatacacaagtagtaattacaaaggca gtgagagattaaaaacaatcatagtgctcgacgtcaaggcgacttgatgg tatgccagtgtcatgaggcacgcaagagttccttgttatagtactacgag tcggccttggcggggcattcgaggctggcgttgaagtggcgggcggggaa cttggcggagacggagcccacctcgaagacaagctcgtctccatcggcgc ggatcccggtgatggaccaccagcggaagaaagccctgacgcggatgccg ctgaggccggagatgcgacggtcgtcgaggtggccggtgaggtggtcgtt gaagttggcgaggtanctccccgccggcancacnatgcggcanctggant ccangtcnacngcnaantccccnnanccnnnntcnanccctcntnncnan ttcctncnnnccnnnnnatncnntannnnnnnannnnncnnnnncnnnnn nnnnntnnnnnt
Download
page-top