Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ588612
Length 502 bp
Fasta Format > rwhsc18h12
gcgccgcgccgcgccgagaaacaaactagcctaaccaacaggtggataca gagacccagattattcaaagtaaacacggctatggtggcgacatcctcct tgcaattaaaatgggggagctgctatacggcttactgcgccttggcgagc tcggcgcggatctgcttggcggcctcgaccatgttggtgagggcgggctt gacctcggcatacttgcgggtcttgagaccgcagtcggggttcacccaca ggatgttggtgtcgagcaccgcgagcatcttgttgacacggtcggcgatc tcctccttggacgggatcctgggggagtggatgtcgtacacgcccgggcc aatgccggcgccgtacaccacgccctcncggaagacgganagaagcttct cgtcngaccgcnagttctcgatggtgatcacatcngcgtccatgttgatg atggactgnatgatntcnttnaanttnnantancacntgtnnntgnnnat ct
Download
page-top