Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ588505
Length 714 bp
Fasta Format > rwhsc18b11
atcggacggcagccctttcgggggttccttagggaccgattcactctgcg tagattgactgaacgcagaaagccttccactggcaggcgatcgngttttt cacaggatttctcgttactcatgtcagcattctcacttctgatatctcca ggtcttgtcaccaaaaaccttccccgattgacagaacgtcccgctactga cacttgaaaaagctgctttcaaggtctcgtcgcttcagngaatcacttga gccctgagacattttcggngccatggagctagaccagtgagctattacgc tttcttcaaaggatggctgcttccaagcccacctcctggttgtcatcgct cgatcacttccttttccactaagtgattgcttagggaccttagcgtacga tctgggctgtttccctctcgactttggatcttagcacccaatcagtctgt ctgtactaaggatgacggcctgtattcggagtttccctggggttggtaaa gcgaaatgggggccaccctagcccattgagtgctctacctcgggccatcg acatcatacgctctactgaaatagatttcgcggaaaaccagctatatccg atcttggttggcctttcacccctanccacaagtcatccccgtattttgcc acatacgtgggttcggtcctccaangcctgttanagctctcttcaacctg ctcatggctanatc
Download
page-top