Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ588313
Length 664 bp
Fasta Format > rwhsc17g13
ctacatcgggtaaacagaatttacataagacaataagatttcttttgttc aaaactaagataaacaaatggtttgagcttgacgcacagctacagccatg ttcaggaagacaaattgctcgttcgcagccgtttgttggatggctttatt agatgtcttgtgaataactgactcgccaccatcctgtgaaactgcatcct tcaaagagggccacatgtctctcgcagaagagtcaccaaacttgcaatgt tttgaagatcacagcttaacctcgccccacatgattctgttgttgctatg aatacaagaaacatcatgtgggcatcctagttgactggtccaactactat catgtagtagaagttctgtagcattctaacaatctcctcctcgtgacaaa acttacaagcttgagacaaaacttgttgaactcgtttcagtgatggaact accaacacaggtttgctgatctgactactcaatactgtcggcatcttttg gttcctagttgctcaccccgtgtcgctcgcataggcaacaccagtgcgca caaccctagccaccgcaggacctcggcatctttctctttttctttggtag cttgcgggttggggtgaggaagtagaggagaccgggatgtagtcnacncg gcactgctcgngtg
Download
page-top