Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ224718
Length 661 bp
Fasta Format > whdl19p22
gttaggtttcagttctcctccgcctccggtctcgagagctcgccagaatg gtcgcccacaggttccaccagtaccaggtggtgggtcgcgcgctgccggc ccccggcgatgagcagcccaagatctaccgcatgaagctctgggccacca atgaggtccgcgccaagtccaagttctggtacttcctgaggaagctcaag aaggtgaagaaggccaacggccagatgctcgccatcaacgagatctttga gaagaaccccaccacaatcaagaactacggcatctggctgaggtaccaga gcaggaccggttaccacaacatgtacaaggagtaccgtgacacgaccctc aacggcggggtggagcagatgtacacggagatggcgtcgcggcaccgcgt gcgtgccccctgcatccagatcatcaagactgcgacggtggacttcaagc tgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttc ccgctggtgtaccagaaggttcgcccacccacccgcaagctcaagaccac ctacaaggcgacgaggcccaacctcttcatgtgagcgggtccctactcta ctggcctgtgtgttttagcgtgtaagagtttgaagatttttgcatgtgga agttttggtta
Download
page-top