Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ587731
Length 730 bp
Fasta Format > rwhsc15e10
aatcatcaggcaaaaggggagctacaagcctcattcatacacacttggaa aaccagcgaaaaggagcatgcatcgcgatgtgcggctgttctgggtggag acgagagtttctaaagagcggaaggtttcatttattcaaaacatccagag gagcagctgcccttcgaatgtggatttacgccaggcatgagtaggccaac gccttctcctctgacagctcctgggcggtcgcatccatcttcttcctcga gaactcatcgatcgggagcccttgaacaattgtccattcaccaccactgc acgttactgggaaggagtagataagaccagcaggcacaccgtatgaacca tcagagtacacacccatggaaacaaatgttccctcagcggttcccagaac ccagtcacggatgtgatcacaagctgagctggcagcagagagagcactgg agagcttcctcgctttgatgattgcagcaccacgctgctggacagtggca atgaactccccatttagccattcatcatcttgaacaagttcacgaacagg cttctctccactgggagtcttcacagtggcatggttaacatcaggatact gactggacgagtgattaccccagataatagcattcttaacgtcagaaact tggacaccaagtctctcagaaatctgaccgagtgccctgttgtggtctag gcgggtcaaacaactgatgttcttctcagg
Download
page-top