Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ587556
Length 609 bp
Fasta Format > rwhsc14k15
aaaagagtacttgattagcaactccattacagatactagttgatgcggaa aacagaaggtaactcatgtccaactaacatgaaccaggcgtcgtctggcg acgccatccacatttattcttcgcatagacaaagcagggacacctctgac caggcgccacaaaggaaagcagagcactctactgagtcttggccatgtgg cggatcaggtcgacaacgcggttgctgtaaccccattcgttgtcatacca cgagacaagcttgacgaaatggtcgttcagagcaattccagccttggcat caaagatgctcgacctgctgtcaccaacaaagtcggtggagaccaaatcc tcctcaacgtaacccatgatccccttgagcttcccctcagatgcagcctt gatagccttcttgatgtcatcatatgatgcagccttctcggttctaacag tgagatcaacaactgacacatccacagtgggaacccggaaagacataccg gtaagcttgccattcagctcaggaagaaccttaccaacagccttagcagc accagtgctgctgggaatgatgttaaagcttgcggccctgccacctctcc agtccttgc
Download
page-top