Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ586957
Length 673 bp
Fasta Format > rwhsc12h12
gttagccggtgacaatggacggaaagagtaaccatctaggtacaagcagg ggcaccccgcggaagaggacatacaccctccaccactagggcatccccgc cggcggcggcgccaacagggagcgctatccgttatagcaggacaatgaca ggaaaaaggtaaaacaacatcacgatgtgaagtgaaacttgggataattc tagtggagatggataggctccttatgacaccaccgcacacagctcaggtc cgttctcgcacagcagctcccgacttgtccgccggagcagccttgacaag atgcgtcttcttcactcgtcatcgtcctcgtcctcatcgctgccctcatc gtcatcgtcgtcattgatctccgacttggacttgtcagattcctcctcat cttcctcctctacctccttggccgcagccttctttggggcagcagcagca gcgctctcgcccttgttgtaggcagcaatggccttgttgtactcgccctt gagcttgttggccttggccacatagggggccttttccgattcgctcaagc tcttccacctctcaccggccgctttgccgacggcggcgacggacttgttc ttggggttcttctgcttgaactcctcgcggaactcgcccatgaagacgaa gaaggcggatggcgccctcttgg
Download
page-top