Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ224628
Length 646 bp
Fasta Format > whdl19j21
tgcaggnaattcggcacgaggnctttgcccaagnccccctactgccggcg gcggagacgacggaaacatggtgcagcgcctgacctaccggaagaggcac agctatgccaccaagtccaaccagacgcgggtcgtcaagaccccaggtgg taagctagtgtaccagtacaccaagaagagggcgagcggccccaagtgcc ctgtgaccgggaagaagatccaggggattccccacctcaggcctactgaa tacaaaagatcaaggttgtctaggaaccgcaggactgtgaaccgtcccta tggtggagtgctctctggaactgcagtgagggaaaggatcatccgcgctt tcttggttgaggagcagaagatcgtgaagaaggtgttgaaaatacagaag accaaggacaagacgacctcaaagtaatctgtttgaaacagaagtgcgaa gtgcgatggtgttctgtaaacaaggaaaatatttttgttggtggttatga tcaatggtttagtcccttctagctaaatgttttagagtacttgaaatcct tctgccgccgtgacatcagagattgtgaaacatttgatacccatttgcag tttcatttctgaatgcatgttgaatctacttatgttaaaaaaaaaa
Download
page-top