Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ586619
Length 453 bp
Fasta Format > rwhsc11c01
gcgggaggaagaaatttacgccaagaaacaccgatgactgaaactantan tggaattcatttgccttcttgaaaaccccagcttgggcagaagcagcacc atcanaggtcacggccacgacgatacagtccttcacctgctgggtggtaa atgggaacttcttgttcacaatggagttgaggtatgcagctgccccctca cgtatcanggcgccaataccatcagttctagtgtttgagagtgcatcatg catatttcctagcttcttgccacctatcatactgcatgcagcaccaaatg tcttgccgatgttgccgagggacccaatanctgcaactatagcatctggg tgattcttccagtagtcgcaggatccaatgaacccatgcttctttggact tgcagggacatcatgggaaggtgnacttggggtgctcggtgtagtgccat aag
Download
page-top