Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ586550
Length 552 bp
Fasta Format > rwhsc10n18
aattctgtcgcaattaatttgggaatgggcacgagaaactgctacaggca atggacatgaaaccggaagtaggaatagtgtcataatctgcattttattt catgcattatgatgctacgaggagcaaaaactgtggcgcatatcatgaaa agaagtcttcaaggaagggttctctcgtagaggggaagggctcccagtgc tttacgctctgctgcctcctttttcaccagagccagcatgtcgctcaaat agcttttgaatggtgtctgcagtgcccggacgtcgtcggggaggtactgg tgcttcatggagaggtccatggcgcgcttgaggcgctggtggcgggcgtc gaccacctcccggggcagcctgccgagcgcctccttgatgtccagatcga agtaggggtcgtacagatcgtcgtacctcangccgaagttcttgaggcgg ttggagatggtgagcatgtggatgcgggccancgggttgcggcgcgggtt cacnaaccacnacnanaacgcngacancatcnacntcatcctgggcnnng nc
Download
page-top