Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ586387
Length 654 bp
Fasta Format > rwhsc10e06
aagtgtgcagcgatatggtaggcaatggagccactaaggccctttgctaa gtaacaactacaaaattccaataacataagaaaccacgacacaagcgcct actgcaggaccctccctctggcttatatgatgccgatcttgttggccacg tcaagagcatcgtagtctggtgtcagcttcacgtacgccttcttcttgcc atcaggcctgatgagggtgttaaccttcttggcctgaatgtcatacattt tcttgacagcagcctttattttcttcttgtcggccttgaggtcgacaatg aagacaagggtgttgttgtcttcaatcttcttcatcgcagactcagtggt aagcgggtacttgaggatctggtactggtctaatttgttccttccagggg tgctgatcctggggtacttggggtccctggccttggacagggtcttgggg cggtgaaatgtcacagaagtgcggatcttctttgccgtcttcttgattga cccanacttcacagccttggcaaccttggcggcctgggccttggcatcnc ccttcttggcaacancaactttgggagccatttgagcttctcanaaaanc ctcttgaacttaccttcctggggngcnggcncnaggcnatgnccnnnnnn nnna
Download
page-top