Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ590820
Length 464 bp
Fasta Format > rwhsc6j08
actttccatgacctctcctcatgtttttatccatgttttttggcagaaag gaaattaaagattgttcagcgggcttcttcctaacccacaagacaaaata aaacagagtgtcgttctcttgtaaaggtaagcttttatttcaagaccaca tcgaagaagcagacatgagggaaccttcagcggctcagccactgcactct ggtgttgatttagatccgaaggcggttagatgtcaaagggtagtctcaag aatgcctccatttgcttcgccctagtcttgatcgacatgtcaaacacctt ctgcccaaattcaatcaccagtcctcccatgatactctggtcaatctttt gttcaaccaagatggttttgtctttcccaaggatatcacgcaaggtctcc ttaagttctttctcctccttatcaggaagtggaacaacagtcctgacaac aactttcacctccc
Download
page-top