Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ590344
Length 797 bp
Fasta Format > rwhsc4l05
aggggagctacaagcctcattcatacacacttggaaaaccagcgaaaagg agcatgcatcgcgatgtgcggctgttctgggtggagacgagagtttctaa agagcggaaggtttcatttattcaaaacatccagaggagcagctgccctt cgaatgtggatttacgccaggcatgagtaggccaacgccttctcctctga cagctcctgggcggtcgcatccatcttcttcctcgagaactcatcgatcg ggagcccttgaacaattgtccattcaccaccactgcacgttactgggaag gagtagataagaccagcaggcacaccgtatgaaccatcagagtacacacc catggaaacaaatgttccctcagcggttcccagaacccagtcacggatgt gatcacaagctgagctggcagcagagagagcactggagagcttcctcgct ttgatgattgcagcaccacgctgctggacagtggcaatgaactccccatt tagccattcatcatcttgaacaagttcacgaacaggcttctctccactgg gagtcttcacagtggcatggttaacatcaggatactgactggacgagtga ttaccccagataatagcattcttaacgtcagaaacttggacaccaagtct ctcagaaatctgaccgagtgccctgttgtggtctaggcgggtcaaacaac tgatgttcttctcagggatagatggagcaaactccttcaggatgagagca ttggtgtttgctgggttggcaacaaccaaaaccttgcaattgggggc
Download
page-top