Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ590039
Length 607 bp
Fasta Format > rwhsc3j06
cacgaacaaaataagataactgaacgctggctaggaatgtcgacagaagt actcaagaaatcagccatcaaaactgactacaaagttcacgacacccagg tggcacatatatcatcttctagatatgaagcagcaaaatagcgacttcta ttttctactcagcagcagcaacctcctccgctccaggaatcacctcatct ccatcagcaggcctgtcaagcttcacaccaacatcctccttgtagtcacc gtgcacctccatgagcttccccaggtcaaacttgggggccttcaggatct tcaccttgcggacgtacacgttctggagggggaagatgcttgaggtggcc ttctcaatctcctttccaatcacctcagggatgaacttgttcacaagctc cttcaagtcacagcttgcagcttggttgaccatgatctcaaccatcttgc ggcggatctgtctgatctgacttgcttgggcatagcaagtgcgcttcacc tggtttgggcgtctcttcgtgaagccaatggtgaacatgcggagcatgta gttgtcagtggtcttcacatccacatgagcctcaatgagtgtctgccact tcctcac
Download
page-top