Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ589977
Length 718 bp
Fasta Format > rwhsc3f11
gtaggacttgtccacttttcttaccggcgataaagaaaaatatatgttta cattgctacatatatttttctttaccgtgccatctaatccatggaattaa tcttgagacctatcatcatctgagatatgtggcaatcaaaatgccgctct catagcgcccctcgtcgcatcacgcttcatctctgcggcctttccacttc ctcggaagtacatgtacacttgctggataacccagatgctcagcaatgac tccagggcaaataatccaaatccaatgaagtagaagatcccaactagagc attcacgctgataagatcaatcgccggtaaaattcctgccaaagacttgc cctcaaagacagcaggaggagccacggcagcaaatacgacgaaaatgatg tgaaacaagtagagcaagaaaaacaatccaaacttcaacgcactgtcagt cctcatagcattataaagagggcgataccataacacatacgcaccaggaa ccccagagatgaagtagattattgctagcaaccagattttcacaccttcc cccttgatccaggctgaagtaactgctacgacattccagaagagacagaa aaccaaaccaagaaatgacgcaaatgcgaagtattgcattctttgaagat gagtcggtatctcattggcaatgtcatggtggatgagtggcagaaaagga ggccagttttttctcctc
Download
page-top