Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ589879
Length 371 bp
Fasta Format > rwhsc2p18
acagggagcgcntatccgtntatancangacantgacaggaaaaaggtaa aacaacatcacgatgtgaagtgaaacttgggataattctagtggagatgg ataggctccttatgacaccaccgnacacagntcangtccgttctcgcaca gcagntccnganttgtccgccggagcagccttgacaagatgcgtcttctt cnntcgtnatcgtcctcgtcctnntcgctgccctcatcgtcatcgtcgtc attgatctccgacttggacttgtcagattcctcctcatcttcctcctcta cctccttggccgcagccttctttggggcagcagcancagcgctctcgccc ttgttgtaggcagcaatggcc
Download
page-top