Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ697622
Length 665 bp
Fasta Format > whsc9f10
agcggcggcgaagatggtgtcgctgaagctgcagaagcgcctggcctcga gcgtcctcaagtgcggcaagggcaaggtctggctcgaccccaatgaggtc aacgagatctccatggccaactcccggcagaacatccggaagctggtaaa ggatggtttcatcatcaggaagcctcagaagatccactccaggtctcgtg caaggagggcacatgaggccaagcagaagggccgtcactctggatatggt aagcgtaggggtaccagggaggctaggctccccaccaagatcctgtggat gcggaggatgcgcgtcctgaggcgccttctgcgcaagtaccgtgaggcca agaagatcgacaagcacatgtaccatgacatgtacctgaaggtcaagggt aacatgttcaagaacaagagggtcctcatggagagtatccacaagtccaa ggctgagaaggcaagagagaagaccctctctgatcagtttgaggccaagc gcgccaagagcaaggcaagcagggagaggaagcatgccangagggaggag agattggctcanggccccanagatcatgcaccancaccagcggctgcagc tccanctccagcancancggcaccaaagaaggccaaggccaanaantgaa ggtctgacatgaanc
Download
page-top