Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ697262
Length 683 bp
Fasta Format > whsc8a20
atggacaagatctccgacaagttccacggtggggactcgtcgtcgtcgtc ctcggactcggacgacgagaagaaggggtcggcggcgggcgtcaaggcca agatctaccgcctcttcggccgcgagaagcccgtccacgccgtcctcggc ggcggcaagcctgctgatcttgttctatggaggaacaagaaggtctccgg aggggtgcttgctggcgctactgccatctggctgctgttcgaggtcatgg agtaccatctgctcaccttggtgggccactgcctcatcctctccctggca accctcttcctctattccaatgtctgcattttcatccacaagtctccccc gaacatccctgaggtgaaaatcccggaggacatgactgtaaacattgcac tatcactgcggcatgagatcaaccggggcttctttaccttgagagagact ggtcatggtcgtgatctgaagaaattcctcattgtgattggagggctctg gcttctttctgttcttgggagctactgcaactttttgacactgtcatata tagtctttgtggtgctgtacactgtgccagttctgtatganaagtacgat gacaaggtggatgcttttggtganaaggccatgatcnaattgaagaanta ttatgccatctttgaananaaggtcctgtcnaa
Download
page-top