Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ696954
Length 512 bp
Fasta Format > whsc6m08
aagtcggccatagtgatccgggagtcccgtgtggaagggctctcgctcaa cggatcaaaggtacgccggggataacaggctgatgactcccaagagctct tatcgacggagtcgtttggcacctcgatgtcgactcatcacatcctgggg ttgaagaaggtcccaagggttcggttgttcgccgatgaaagtggtacgtg agttgggtttagaacgtcgtgagacagttcggttcctatctaccgttggt gttaaagggagaactgcgaggagccagccctagtacgagaggactgggct gggtcaacctatggtgtaccggttgttatgccaatagcagcgccgggcag ctaagttggtatggaagaactgctgcgccgcgggaaatccttctctatac aagttctcgtacgaggtttttgaacanaacttcnataggcgagaggtgta agcaccgcgaggtgtgaancgatctcgtactaaacgaatggaaattgaca acaaaaaaaaaa
Download
page-top