Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695445
Length 162 bp
Fasta Format > whsc20a05
ggcaaggtaccccgctctacaacatcnaggcctacctccccgtcattgaa tcctttgggttctcaagcaccctgagggccgcgacgtcnggncangnctt cccccagtgtgtgtttgaccactgggacatcatggcttctgatcctttgg acccaggcaccc
Download
page-top