Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695038
Length 656 bp
Fasta Format > whsc19h04
ccactctccctatccccgtgtccagaatctaccccccggctccaatggcg gcgaaggaaccgatgcgcgtgctcgtcaccggcgccgcaggacaaatcgg atatgctcttgttcccatgattgccaggggagttatgcttggtgcagacc agcctgttattctgcatatgctggatattgaatttgctgctgaagctctt aaaggcgtcaagatggagttgatcgatgccgcatttccacttctcaaggg agttgttgcaacaactgatgttgttgaggcttgcactggtgtgaatgttg cggttatggttggtggattccccaggaaggaaggaatggaaaggaaggat gttatgacgaaaaatgtttcaatctacaaagctcaagcatctgctcttga agctcatgcagcccccaattgcaaggttttggttgttgccaacccagcaa acaccaatgctctcatcctgaaggagtttgctccatctatccctgagaag aacatcagttgtttgacccgcctagaccacaacagggcactcggtcagat ttctgagagacttggtgtccaagtttctgacgttaagaatgctattatct ggggtaatcactcgtccagtcantatcctgatgttaaccatgccactgtg aagact
Download
page-top